RQV30031 | |
I. Background | |
2019-nCov, as a new coronavirus, is a type of RNA virus with an envelope and a linear single-stranded genome. The relevant sequences of virus samples collected from patients in different regions have also been released to the 2019 new coronavirus information library. (https://bigd.big.ac.cn/ncov)。The sequence included in NCBI is NC_045512.2, with a total length of 29903bp, and the gene encodes 4 structural proteins: S, M, N and E. In order to meet the needs of clinical diagnosis, as of now, the country has urgently approved several nucleic acid diagnostic kits for clinical diagnosis, most of which are using RT-PCR methods. Clinical test results for many days show that the diagnosis A high proportion of false negative problems often require multiple tests before they can be finally verified. At the same time, the Ministry of Science and Technology is also an emergency call for rapid diagnostic products in addition to ordinary real-time quantitative fluorescent PCR. Viruses while monitoring virus mutations. Regardless of the type of product, the detection limit of the kit is the biggest cause of false negatives. Therefore, for the detection limit of diagnostic products, we need to carefully evaluate the performance of each kit. In the past, performance evaluations for detection limits generally used in vitro transcribed RNA or clinically positive viruses as standard products for performance evaluation. However, both have obvious determinations. First, RNA transcribed in vitro is generally very pure, single, does not involve extraction, and does not conform to the microenvironment of clinical viruses. Therefore, it will inevitably cause the detection sensitivity to be overestimated, which is also a high probability of false The main reason for negative; once again clinically positive viruses, even inactivated viruses, have great potential for biological safety, so the laboratory level is required to be P3-P4, and most of the diagnostic kits developed do not meet the requirements for change Clinical positive viruses are also very limited in source and cannot be supplied steadily. They have been used repeatedly for kit performance evaluation. | |
II.Product description | |
It has the complete envelope structure of the virus and the nucleic acid sequence corresponding to 2019-nCov, but the pseudovirus standard with low biological safety risk perfectly overcomes the shortcomings of selecting RNA transcribed in vitro or clinically positive virus as the standard. Very suitable for nucleic acid diagnosis of new coronavirus 2019-nCov. Construction process: 2019-nCov gene synthesis → fake virus packaging → purification → QC detection (ddPCR) | |
III. Product description | |
Product name: | 2019-nCov-S Pseudovirus Standard Reference |
Corresponding sequence (see appendix for details): | Gene S(3362bp) |
Specifications: | 1ml |
Copy number: | |
Biosecurity level: | P2 |
Transportation and storage: | Dry ice transportation, stored at -80℃ |
Validity period: | |
IV. Product use and advantages | |
Product Usage: | 2019-nCov nucleic acid diagnostic kit performance evaluation |
Product advantages: | ·The 2019-nCov fake virus standard is different from RNA synthesized in vitro and live clinically positive virus, which perfectly overcomes the shortcomings of the two, and is truly suitable for performance evaluation of the kit, including detection limit, specificity, repeatability, etc; ·According to the characteristics of the new coronavirus, a total of 3 ORF1ab / RdRP (RNA-dependent RNA poly、erase), Gene E (envelope protein), and Gene N (nucleocapsid phosphoprotein) 、Gene S、Gene M sequences were selected for the packaging of pseudoviruses, 5 The section well characterizes the feature sequence of 2019-nCov; ·Reqbio Bio has designed the primer and probe sequences of the ddPCR system, which can complete the QC copy number detection of pseudoviruses without the need to construct a standard curve. It very accurately characterizes the copy number of standard products and overcomes the CT value of Q-PCR analysis The inaccuracy of the relative judgment standard; ·Pseudovirus standard, non-pathogenic, reproducible, reliable quality control method, stable between batches, stable and long-term preparation and supply, and requires laboratory biosecurity level P2, to meet the safety needs of many units. |
Ⅴ. Appendix | |
atgtttgtttttcttgttttattgccactagtctctagtcagtgtgttaatcttacaaccagaactcaattaccccctgcatacactaattctttcacacgtggtgtttattaccctgacaaagttttcagatcctcagttttacattcaactcaggacttgttcttacctttcttttccaatgttacttggttccatgctatacatgtctctgggaccaatggtactaagaggtttgataaccctgtcctaccatttaatgatggtgtttattttgcttccactgagaagtctaacataataagaggctggatttttggtactactttagattcgaagacccagtccctacttattgttaataacgctactaatgttgttattaaagtctgtgaatttcaattttgtaatgatccatttttgggtgtttattaccacaaaaacaacaaaagttggatggaaagtgagttcagagtttattctagtgcgaataattgcacttttgaatatgtctctcagccttttcttatggaccttgaaggaaaacagggtaatttcaaaaatcttagggaatttgtgtttaagaatattgatggttattttaaaatatattctaagcacacgcctattaatttagtgcgtgatctccctcagggtttttcggctttagaaccattggtagatttgccaataggtattaacatcactaggtttcaaactttacttgctttacatagaagttatttgactcctggtgattcttcttcaggttggacagctggtgctgcagcttattatgtgggttatcttcaacctaggacttttctattaaaatataatgaaaatggaaccattacagatgctgtagactgtgcacttgaccctctctcagaaacaaagtgtacgttgaaatccttcactgtagaaaaaggaatctatcaaacttctaactttagagtccaaccaacagaatctattgttagatttcctaatattacaaacttgtgcccttttggtgaagtttttaacgccaccagatttgcatctgtttatgcttggaacaggaagagaatcagcaactgtgttgctgattattctgtcctatataattccgcatcattttccacttttaagtgttatggagtgtctcctactaaattaaatgatctctgctttactaatgtctatgcagattcatttgtaattagaggtgatgaagtcagacaaatcgctccagggcaaactggaaagattgctgattataattataaattaccagatgattttacaggctgcgttatagcttggaattctaacaatcttgattctaaggttggtggtaattataattacctgtatagattgtttaggaagtctaatctcaaaccttttgagagagatatttcaactgaaatctatcaggccggtagcacaccttgtaatggtgttgaaggttttaattgttactttcctttacaatcatatggtttccaacccactaatggtgttggttaccaaccatacagagtagtagtactttcttttgaacttctacatgcaccagcaactgtttgtggacctaaaaagtctactaatttggttaaaaacaaatgtgtcaatttcaacttcaatggtttaacaggcacaggtgttcttactgagtctaacaaaaagtttctgcctttccaacaatttggcagagacattgctgacactactgatgctgtccgtgatccacagacacttgagattcttgacattacaccatgttcttttggtggtgtcagtgttataacaccaggaacaaatacttctaaccaggttgctgttctttatcaggatgttaactgcacagaagtccctgttgctattcatgcagatcaacttactcctacttggcgtgtttattctacaggttctaatgtttttcaaacacgtgcaggctgtttaataggggctgaacatgtcaacaactcatatgagtgtgacatacccattggtgcaggtatatgcgctagttatcagactcagactaattctcctcggcgggcacgtagtgtagctagtcaatccatcattgcctacactatgtcacttggtgcagaaaattcagttgcttactctaataactctattgccatacccacaaattttactattagtgttaccacagaaattctaccagtgtctatgaccaagacatcagtagattgtacaatgtacatttgtggtgattcaactgaatgcagcaatcttttgttgcaatatggcagtttttgtacacaattaaaccgtgctttaactggaatagctgttgaacaagacaaaaacacccaagaagtttttgcacaagtcaaacaaatttacaaaacaccaccaattaaagattttggtggttttaatttttcacaaatattaccagatccatcaaaaccaagcaagaggtcatttattgaagatctacttttcaacaaagtgacacttgcagatgctggcttcatcaaacaatatggtgattgccttggtgatattgctgctagagacctcatttgtgcacaaaagtttaacggccttactgttttgccacctttgctcacagatgaaatgattgctcaatacacttctgcactgttagcgggtacaatcacttctggttggacctttggtgcaggtgctgcattacaaataccatttgctatgcaaatggcttataggtttaatggtattggagttacacagaatgttctctatgagaaccaaaaattgattgccaaccaatttaatagtgctattggcaaaattcaagactcactttcttccacagcaagtgcacttggaaaacttcaagatgtggtcaaccaaaatgcacaagctttaaacacgcttgttaaacaacttagctccaattttggtgcaatttcaagtgttttaaatgatatcctttcacgtcttgacaaagttgaggctgaagtgcaaattgataggttgatcacaggcagacttcaaagtttgcagacatatgtgactcaacaattaattagagctgcagaaatcagagcttctgctaatcttgctgctactaaaatgtcagagtgtgtacttggacaatcaaaaagagttgatttttgtggaaagggctatcatcttatgtccttccctcagtcagcacctcatggtgtagtcttcttgcatgtgacttatgtccctgcacaagaaaagaacttcacaactgctcctgccatttgtcatgatggaaaagcacactttcctcgtgaaggtgtctttgtttcaaatggcacacactggtttgtaacacaaaggaatttttatgaaccacaaatcattactacagacaacacatttgtgtctggtaactgtgatgttgtaataggaattgtcaacaacacagtttatgatcctttgcaacctgaattagactcattcaaggaggagttagataaatattttaagaatcatacatcaccagatgttgatttaggtgacatctctggcattaatgcttcagttgtaaacattcaaaaagaaattgaccgcctcaatgaggttgccaagaatttaaatgaatctctcatcgatctccaagaacttggaaagtatgagcagtatataaaatggccatggtacatttggctaggttttatagctggcttgattgccatagtaatggtgacaattatgctttgctgtatgaccagttgctgtagttgtctcaagggctgttgttcttgtggatcctgctgcaaatttgatgaagacgactctgagccagtgctcaaaggagtcaaattacattacacataa |
Corresponding product line:
Catalog ID | Product | Unit Size | Remarks |
RQV30001 | 2019-nCov-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2995bp) |
RQV30002 | 2019-nCov-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1260bp) |
RQV30003 | 2019-nCov-E Pseudovirus Standard Reference | 1ml | Contains Gene E fragments(228bp) |
RQV30004 | SARS-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2795bp) |
RQV30005 | SARS-M Pseudovirus Standard Reference | 1ml | Contains Gene M fragments(666bp) |
RQV30006 | SARS-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1207bp) |
RQV30007 | SARS-E Pseudovirus Standard Reference | 1ml | Contains Gene E fragments(231bp) |
RQV30008 | MERS-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2798bp) |
RQV30009 | MERS-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1242bp) |
RQV30010 | MERS-uPE/E Pseudovirus Standard Reference | 1ml | Contains uPE/E fragments(999bp) |
RQV30011 | hCov-229E-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2780bp) |
RQV30012 | hCov-229E-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1170bp) |
RQV30013 | hCov-229E-E Pseudovirus Standard Reference | 1ml | Contains Gene E fragments(234bp) |
RQV30014 | hCov-HKU1-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2783bp) |
RQV30015 | hCov-HKU1-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1326bp) |
RQV30016 | hCov-HKU1-E Pseudovirus Standard Reference | 1ml | Contains Gene E fragments(249bp) |
RQV30017 | hCov-NL63-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2780bp) |
RQV30018 | hCov-NL63-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1134bp) |
RQV30019 | hCov-NL63-E Pseudovirus Standard Reference | 1ml | Contains Gene E fragments(234bp) |
RQV30020 | hCov-OC43-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2783bp) |
RQV30021 | hCov-OC43-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1347bp) |
RQV30022 | hCov-OC43-E Pseudovirus Standard Reference | 1ml | Contains Gene E fragments(255bp) |