RQV30016 | |
I. Background | |
hCov-HKU1 was discovered in Hong Kong in 2005 and is a common cause of self-limiting infections of the upper and lower respiratory tract, most commonly in young children. Without laboratory diagnosis, usually by reverse transcription polymerase chain reaction (RT-PCR) of respiratory samples, HCoV-HKU1 respiratory infection cannot be distinguished from infections caused by other respiratory viruses. Treatment should be symptomatic and meet general guidelines to support viral respiratory infections. According to the introduction of CDC and WHO, nucleic acid diagnosis for hCov-HKU1 is generally for RdRP (RNA-dependent RNA polymerase), Gene N and Gene E, Gene S is more used for the development of corresponding drugs and vaccines. The sequence included in NCBI is KF686346, with a total length of 29982. The gene encodes 5 structural proteins: S, M, N, HE, and E. In the past, the performance evaluation of the detection limit of the kit was generally to select RNA transcribed in vitro or clinically positive virus as a standard for performance evaluation. However, both have obvious determinations. First, RNA transcribed in vitro is generally very pure, single, does not involve extraction, and does not conform to the microenvironment of clinical viruses. Therefore, it will inevitably cause the detection sensitivity to be overestimated, which is also a high probability of false The main reason for negative; once again clinically positive viruses, even inactivated viruses, have great potential for biological safety, so the laboratory level is required to be P3-P4, and most of the diagnostic kits developed do not meet the requirements for change. In addition Clinical positive viruses are also very limited in source and cannot be supplied steadily. They have been used repeatedly for kit performance evaluation. | |
II.Product description | |
It has the complete envelope structure of the virus and the nucleic acid sequence corresponding to HCoV-HKU1, but the pseudovirus standard with low biological safety risk perfectly overcomes the shortcomings of selecting RNA transcribed in vitro or clinically positive virus as the standard It is very suitable for standard products used for nucleic acid diagnostic performance evaluation. Construction process: HCoV-HKU1 gene synthesis → fake virus packaging → purification → QC detection (ddPCR) | |
III. Product information | |
Product name: | hCov-HKU1-E Pseudovirus Standard Reference |
Corresponding sequence (see appendix for details): | Gene E(249bp) |
Specifications: | 1ml |
Copy number: | |
Biosecurity level: | P2 |
Transportation and storage: | Dry ice transportation, stored at -80℃ |
Validity period: | |
IV. Product use and advantages | |
Product Usage: | Performance evaluation of HCoV-HKU1 diagnostic kit |
Product advantages: | ·The fake virus standard of HCoV-HKU1 is different from RNA synthesized in vitro and live clinically positive virus. It perfectly overcomes the shortcomings of the two and is truly suitable for performance evaluation of the kit, including detection limit, specificity, repeatability, etc; ·According to the characteristics of HCoV-HKU1 coronavirus, a total of 3 sequences of ORF1ab / RdRP (RNA-dependent RNA polymerase), Gene E (envelope protein), Gene N (nucleocapsid phosphoprotein) were selected for the packaging of pseudoviruses. Three sections well characterize the sequence of HCoV-HKU1; ·Reqbio Bio has designed the primer and probe sequences of the ddPCR system, which can complete the QC copy number detection of pseudoviruses without the need to construct a standard curve. It very accurately characterizes the copy number of standard products and overcomes the CT value of Q-PCR analysis The inaccuracy of the relative judgment standard; ·Pseudovirus standard, non-pathogenic, reproducible, reliable quality control method, stable between batches, stable and long-term preparation and supply, and requires laboratory biosecurity level P2, to meet the safety needs of many units. |
Ⅴ. Appendix | |
Gene E: ATGGTTGATTTATTTTTCAATGATACTGCTTGGTACATAGGACAGATTTTAGTTTTAGTTTTATTTTGTCTTATTTCTTTAATCTTTGTTGTTGCTTTTTTAGCAACTATTAAGCTTTGTATGCAACTTTGTGGTTTTTGTAATTTCTTTATTATTTCACCTTCGGCTTACGTTTATAAAAGAGGTATGCAGTTGTATAAGTCTTATAGTGAACAAGTTATACCACCCACTTCAGATTATTTAATCTAA |
对应的产品线:
Catalog ID | Product | Unit Size | Remarks |
RQV30001 | 2019-nCov-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2995bp) |
RQV30002 | 2019-nCov-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1260bp) |
RQV30003 | 2019-nCov-E Pseudovirus Standard Reference | 1ml | Contains Gene E fragments(228bp) |
RQV30004 | SARS-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2795bp) |
RQV30005 | SARS-M Pseudovirus Standard Reference | 1ml | Contains Gene M fragments(666bp) |
RQV30006 | SARS-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1207bp) |
RQV30007 | SARS-E Pseudovirus Standard Reference | 1ml | Contains Gene E fragments(231bp) |
RQV30008 | MERS-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2798bp) |
RQV30009 | MERS-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1242bp) |
RQV30010 | MERS-uPE/E Pseudovirus Standard Reference | 1ml | Contains uPE / E fragments(999bp) |
RQV30011 | hCov-229E-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2780bp) |
RQV30012 | hCov-229E-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1170bp) |
RQV30013 | hCov-229E-E Pseudovirus Standard Reference | 1ml | Contains Gene E fragments(234bp) |
RQV30014 | hCov-HKU1-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2783bp) |
RQV30015 | hCov-HKU1-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1326bp) |
RQV30016 | hCov-HKU1-E Pseudovirus Standard Reference | 1ml | Contains Gene E fragments(249bp) |
RQV30017 | hCov-NL63-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2780bp) |
RQV30018 | hCov-NL63-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1134bp) |
RQV30019 | hCov-NL63-E Pseudovirus Standard Reference | 1ml | Contains Gene E fragments(234bp) |
RQV30020 | hCov-OC43-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2783bp) |
RQV30021 | hCov-OC43-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1347bp) |
RQV30022 | hCov-OC43-E Pseudovirus Standard Reference | 1ml | Contains Gene E fragments(255bp) |