hCov-NL63 was first isolated from the aspirate from a 7-month-old baby in the Netherlands in early 2004. Since then, HCoV-NL63 infection has proved to be a widespread disease worldwide and is associated with many clinical symptoms. Diagnosis includes severe lower respiratory tract infections, buttocks and bronchiolitis. HCoV-NL63 causes childhood diseases. The elderly and immunocompromised children account for 1.0-9.3% of childhood respiratory infections.

   According to the introduction of CDC and WHO, nucleic acid diagnosis for HCoV-NL63 is generally for RdRP (RNA-dependent RNA polymerase), Gene N and Gene E, Gene S is more used for the development of corresponding drugs and vaccines. The sequence included in NCBI is JX504050.1, with a total length of 27553bp. The gene encodes four structural proteins: S, M, N and E.

   In the past, the performance evaluation of the detection limit of the kit was generally to select RNA transcribed in vitro or clinically positive virus as a standard for performance evaluation. However, both have obvious determinations. First, RNA transcribed in vitro is generally very pure, single, does not involve extraction, and does not conform to the microenvironment of clinical viruses. Therefore, it will inevitably cause the detection sensitivity to be overestimated, which is also a high probability of false The main reason for negative; once again clinically positive viruses, even inactivated viruses, have great potential for biological safety, so the laboratory level is required to be P3-P4, and most of the diagnostic kits developed do not meet the requirements for change. In addition Clinical positive viruses are also very limited in source and cannot be supplied steadily. They have been used repeatedly for kit performance evaluation.

   It has the complete envelope structure of the virus and the nucleic acid sequence corresponding to HCoV-NL63, but the pseudovirus standard with low biological safety risk perfectly overcomes the shortcomings of selecting RNA transcribed in vitro or clinically positive virus as the standard It is very suitable for standard products used for nucleic acid diagnostic performance evaluation.

   Construction process: HCoV-NL63 gene synthesis → fake virus packaging → purification → QC detection (ddPCR)

Gene N（1134bp）

·According to the characteristics of HCoV-NL63 coronavirus, a total of 3 sequences of ORF1ab / RdRP (RNA-dependent RNA polymerase), Gene E (envelope protein), Gene N (nucleocapsid phosphoprotein) were selected for the packaging of pseudovirus Three sections well characterize the sequence of HCoV-NL63;

·Reqbio Bio has designed the primer and probe sequences of the ddPCR system, which can complete the QC copy number detection of pseudoviruses without the need to construct a standard curve. It very accurately characterizes the copy number of standard products and overcomes the CT value of Q-PCR analysis The inaccuracy of the relative judgment standard;

·Pseudovirus standard, non-pathogenic, reproducible, reliable quality control method, stable between batches, stable and long-term preparation and supply, and requires laboratory biosecurity level P2, to meet the safety needs of many units.

Gene N:

ATGGCTAGTGTAAATTGGGCCGATGACAGAGCTGCTAGGAAGAAATTTCCTCCTCCTTCATTTTACATGCCTCTTTTGGTTAGTTCTGATAAGGCACCATATAGGGTCATTCCCAGGAATCTTGTCCCTATTGGTAAGGGTAATAAAGATGAGCAGATTGGTTATTGGAATGTTCAAGAGCGTTGGCGTATGCGCAGGGGGCAACGTGTTGATTTGCCTCCTAAAGTTCATTTTTATTACCTAGGTACTGGACCTCATAAGGACCTTAAATTCAGACAACGTTCTGATGGTGTTGTTTGGGTTGCTAAGGAAGGTGCTAAAACTGTTAATACCAGTCTTGGTAATCGCAAACGTAATCAGAAACCTTTGGAACCAAAGTTCTCTATTGCTTTGCCTCCAGAGCTCTCTGTTGTTGAGTTTGAGGATCGCTCTAATAACTCATCTCGTGCTAGCAGTCGTTCTTCAACTCGTAACAACTCACGAGACTCTTCTCGTAGCACTTCAAGACAACAGTCTCGCACTCGTTCTGATTCTAACCAGTCTTCTTCAGATCTTGTTGCTGCTGTTACTTTGGCTTTAAAGAACTTAGGTTTTGATAACCAGTCGAAGTCACCTAGTTCTTCTGGTACTTCCACTCCTAAGAAACCTAATAAGCCTCTTTCTCAACCCAGGGCTGATAAGCCTTCTCAGTTGAAGAAACCTCGTTGGAAGCGTGTTCCTACCAGAGAGGAAAATGTTATTCAGTGCTTTGGTCCTCGTGATTTTAATCACAATATGGGGGATTCAGATCTTGTTCAGAATGGTGTTGATGCCAAAGGTTTTCCACAGCTTGCTGAATTGATTCCTAATCAGGCTGCGTTATTCTTTGATAGTGAGGTTAGCACTGATGAAGTGGGTGATAATGTTCAGATTACCTACACCTACAAAATGCTTGTAGCTAAGGATAATAAGAACCTTCCTAAGTTCATTGAGCAGATTAGTGCTTTTACTAAACCCAGTTCTATCAAAGAAATGCAGTCACAATCATCTCATGTTGCTCAGAACACAGTACTTAATGCTTCTATTCCAGAATCTAAACCATTGGCTGATGATGATTCAGCCATTATAGAAATTGTCAACGAGGTTTTGCATTAA