RQV30022 | |
I. Background | |
Both HCoV-229E and HCoV-OC43 were discovered in the 1960s and have been recognized as the cause of the common cold for many years, and have caused frequent reinfections throughout life. Among adults, these viruses account for 4% to 15% of acute respiratory diseases each year, and as high as 35% during peak periods. The annual incidence of children reaches 8%, and the highest incidence is as high as 20%. According to reports, the frequency of infection of the 229E and OC43 viruses in adults ranges from 15 to 25 per 100 people per year, of which 80% of the infected people are those who previously had antibodies to the infected virus. According to the introduction of CDC and WHO, nucleic acid diagnosis for HCoV-OC43 is generally for ORF1ab / RdRP (RNA-dependent RNA polymerase), Gene N and Gene E, Gene S is more used for the development of corresponding drugs and vaccines. The sequence included in NCBI is KX344031.1, with a total length of 30713bp. The gene encodes 5 structural proteins: S, M, N, HE and E. In the past, the performance evaluation of the detection limit of the kit was generally to select RNA transcribed in vitro or clinically positive virus as a standard for performance evaluation. However, both have obvious determinations. First, RNA transcribed in vitro is generally very pure, single, does not involve extraction, and does not conform to the microenvironment of clinical viruses. Therefore, it will inevitably cause the detection sensitivity to be overestimated, which is also a high probability of false The main reason for negative; once again clinically positive viruses, even inactivated viruses, have great potential for biological safety, so the laboratory level is required to be P3-P4, and most of the diagnostic kits developed do not meet the requirements for change Clinical positive viruses are also very limited in source and cannot be supplied steadily. They have been used repeatedly for kit performance evaluation. | |
II.Product description | |
It has the complete envelope structure of the virus and the nucleic acid sequence corresponding to HCoV-OC43, but the pseudovirus standard with low biological safety risk perfectly overcomes the shortcomings of selecting RNA transcribed in vitro or clinically positive virus as the standard. It is very suitable for standard products used for nucleic acid diagnostic performance evaluation. Construction process: HCoV-OC43 gene synthesis → fake virus packaging → purification → QC detection (ddPCR) | |
III. Product information | |
Product name: | hCov-OC43-E Pseudovirus Standard Reference |
Corresponding sequence (see appendix for details): | Gene E(255bp) |
Specifications: | 1ml |
Copy number: | |
Biosecurity level: | P2 |
Transportation and storage: | 干冰运输,-80°C保存 |
Validity period: | |
IV. Product use and advantages | |
Product Usage: | Performance evaluation of HCoV-OC43 diagnostic kit |
Product advantages: | ·The fake virus standard of HCoV-OC43 is different from RNA synthesized in vitro and live clinically positive virus, which perfectly overcomes the shortcomings of the two, and is truly suitable for performance evaluation of the kit, including detection limit, specificity, repeatability, etc; ·According to the characteristics of HCoV-OC43 coronavirus, a total of 3 sequences of ORF1ab / RdRP (RNA-dependent RNA polymerase), Gene E (envelope protein) and Gene N (nucleocapsid phosphoprotein) were selected for the packaging of pseudoviruses. Three sections well characterize the sequence of HCoV-OC43; ·Reqbio Bio has designed the primer and probe sequences of the ddPCR system, which can complete the QC copy number detection of pseudoviruses without the need to construct a standard curve. It very accurately characterizes the copy number of standard products and overcomes the CT value of Q-PCR analysis The inaccuracy of the relative judgment standard; ·Pseudovirus standard, non-pathogenic, reproducible, reliable quality control method, stable between batches, stable and long-term preparation and supply, and requires laboratory biosecurity level P2, to meet the safety needs of many units. |
Ⅴ. Appendix | |
Gene E: ATGTTTATGGCTGATGCTTATCTTGCAGACACTGTGTGGTATGTGGGGCAAATAATTTTTATAGTTGCCATTTGTTTATTGGTTACAATAGTTGTAGTGGCATTTTTGGCAACTTTTAAATTGTGTATTCAACTTTGCGGTATGTGTAATACCTTAGTACTGTCCCCTTCTATTTATGTGTTTAATAGAGGTAGGCAGTTTTATGAGTTTTACAATGATGTAAAACCACCAGTCCTTGATGTGGATGACGTTTAG |
Corresponding product line:
Catalog ID | Product | Unit Size | Remarks |
RQV30001 | 2019-nCov-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2995bp) |
RQV30002 | 2019-nCov-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1260bp) |
RQV30003 | 2019-nCov-E Pseudovirus Standard Reference | 1ml | Contains Gene E fragments(228bp) |
RQV30004 | SARS-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2795bp) |
RQV30005 | SARS-M Pseudovirus Standard Reference | 1ml | Contains Gene M fragments(666bp) |
RQV30006 | SARS-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1207bp) |
RQV30007 | SARS-E Pseudovirus Standard Reference | 1ml | Contains Gene E fragments(231bp) |
RQV30008 | MERS-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2798bp) |
RQV30009 | MERS-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1242bp) |
RQV30010 | MERS-uPE/E Pseudovirus Standard Reference | 1ml | Contains uPE / E fragments(999bp) |
RQV30011 | hCov-229E-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2780bp) |
RQV30012 | hCov-229E-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1170bp) |
RQV30013 | hCov-229E-E Pseudovirus Standard Reference | 1ml | Contains Gene E fragments(234bp) |
RQV30014 | hCov-HKU1-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2783bp) |
RQV30015 | hCov-HKU1-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1326bp) |
RQV30016 | hCov-HKU1-E Pseudovirus Standard Reference | 1ml | Contains Gene E fragments(249bp) |
RQV30017 | hCov-NL63-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2780bp) |
RQV30018 | hCov-NL63-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1134bp) |
RQV30019 | hCov-NL63-E Pseudovirus Standard Reference | 1ml | Contains Gene E fragments(234bp) |
RQV30020 | hCov-OC43-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2783bp) |
RQV30021 | hCov-OC43-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1347bp) |
RQV30022 | hCov-OC43-E Pseudovirus Standard Reference | 1ml | Contains Gene E fragments(255bp) |