RQV30010 | |
I. Background | |
Middle East Respiratory Syndrome (MERS) was first reported in Saudi Arabia in 2012 and has since spread to several other countries including the United States. Most people infected with MERS-CoV have severe respiratory diseases including fever, cough and shortness of breath. Many of them have died. MERS belongs to a coronavirus. It is a type of RNA virus with an envelope and a linear single-stranded genome. The corresponding schematic diagram is as follows:
According to the introduction of CDC and WHO, nucleic acid diagnosis for MERS is generally for RdRP (RNA-dependent RNA polymerase), Gene N and Gene upE / E, Gene S is more used for the development of corresponding drugs and vaccines. The sequence included in NCBI is NC_019843.3, with a total length of 30119bp. The gene encodes 4 structural proteins: S, M, N and E. In the past, the performance evaluation of the detection limit of the kit was generally to select RNA transcribed in vitro or clinically positive virus as a standard for performance evaluation. However, both have obvious determinations. First, RNA transcribed in vitro is generally very pure, single, does not involve extraction, and does not conform to the microenvironment of clinical viruses. Therefore, it will inevitably cause the detection sensitivity to be overestimated, which is also a high probability of false The main reason for negative; once again clinically positive viruses, even inactivated viruses, have great potential for biological safety, so the laboratory level is required to be P3-P4, and most of the diagnostic kits developed do not meet the requirements for change Clinical positive viruses are also very limited in source and cannot be supplied steadily. They have been used repeatedly for kit performance evaluation. | |
II.Product description | |
It has the complete envelope structure of the virus and the nucleic acid sequence corresponding to MERS, but the pseudovirus standard with low biological safety risk perfectly overcomes the shortcomings of selecting RNA transcribed in vitro or clinically positive virus as the standard, and is very suitable. Standards for nucleic acid diagnostic performance evaluation. Construction process: MERS gene synthesis → fake virus packaging → purification → QC detection (ddPCR) | |
III. Product information | |
Product name: | MERS-uPE/E Pseudovirus Standard Reference |
Corresponding sequence (see appendix for details): | uPE/E(996bp) |
Specifications: | 1ml |
Copy number: | |
Biosecurity level: | P2 |
Transportation and storage: | Dry ice transportation, stored at -80℃ |
Validity period: | |
IV. Product use and advantages | |
Product Usage: | Performance evaluation of MERS diagnostic kit |
Product advantages: | ·MERS pseudo-virus standard is different from RNA synthesized in vitro and live clinically positive virus, which perfectly overcomes the shortcomings of the two, and is truly suitable for the performance evaluation of the kit, including detection limit, specificity, repeatability, etc; ·According to the characteristics of MERS coronavirus, a total of 3 sequences of ORF1ab / RdRP (RNA-dependent RNA polymerase), Gene E (envelope protein), Gene N (nucleocapsid phosphoprotein) were selected for the packaging of pseudoviruses The section characterizes the characteristic sequence of MERS well; ·Reqbio Bio has designed the primer and probe sequences of the ddPCR system, which can complete the QC copy number detection of pseudoviruses without the need to construct a standard curve. It very accurately characterizes the copy number of standard products and overcomes the CT value of Q-PCR analysis The inaccuracy of the relative judgment standard; ·Pseudovirus standard, non-pathogenic, reproducible, reliable quality control method, stable between batches, stable and long-term preparation and supply, and requires laboratory biosecurity level P2, to meet the safety needs of many units. |
Ⅴ. Appendix | |
uPE/E: ATGGCTTTCTCGGCGTCTTTATTTAAACCCGTCCAGCTAGTCCCAGTTTCTCCTGCATTTCATCGCATTGAGTCTACTGACTCTATTGTTTTCACATACATTCCTGCTAGCGGCTATGTAGCTGCTTTAGCTGTCAATGTGTGTCTCATTCCCCTATTATTACTGCTACGTCAAGATACTTGTCGTCGCAGCATTATCAGAACTATGGTTCTCTATTTCCTTGTTCTGTATAACTTTTTATTAGCCATTGTACTAGTCAATGGTGTACATTATCCAACTGGAAGTTGCCTGATAGCCTTCTTAGTTATCCTCATAATACTTTGGTTTGTAGATAGAATTCGTTTCTGTCTCATGCTGAATTCCTACATTCCACTGTTTGACATGCGTTCCCACTTTATTCGTGTTAGTACAGTTTCTTCTCATGGTATGGTCCCTGTAATACACACCAAACCATTATTTATTAGAAACTTCGATCAGCGTTGCAGCTGTTCTCGTTGTTTTTATTTGCACTCTTCCACTTATATAGAGTGCACTTATATTAGCCGTTTTAGTAAGATTAGCCTAGTTTCTGTAACTGACTTCTCCTTAAACGGCAATGTTTCCACTGTTTTCGTGCCTGCAACGCGCGATTCAGTTCCTCTTCACATAATCGCCCCGAGCTCGCTTATCGTTTAAGCAGCTCTGCGCTACTATGGGTCCCGTGTAGAGGCTAATCCATTAGTCTCTCTTTGGACATATGGAAAACGAACTATGTTACCCTTTGTCCAAGAACGAATAGGGTTGTTCATAGTAAACTTTTTCATTTTTACCGTAGTATGTGCTATAACACTCTTGGTGTGTATGGCTTTCCTTACGGCTACTAGATTATGTGTGCAATGTATGACAGGCTTCAATACCCTGTTAGTTCAGCCCGCATTATACTTGTATAATACTGGACGTTCAGTCTATGTAAAATTCCAGGATAGTAAACCCCCTCTACCACCTGACGAGTGGGTTTAA |
Corresponding product line:
Catalog ID | Product | Unit Size | Remarks |
RQV30001 | 2019-nCov-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2995bp) |
RQV30002 | 2019-nCov-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1260bp) |
RQV30003 | 2019-nCov-E Pseudovirus Standard Reference | 1ml | Contains Gene E fragments(228bp) |
RQV30004 | SARS-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2795bp) |
RQV30005 | SARS-M Pseudovirus Standard Reference | 1ml | Contains Gene M fragments(666bp) |
RQV30006 | SARS-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1207bp) |
RQV30007 | SARS-E Pseudovirus Standard Reference | 1ml | Contains Gene E fragments(231bp) |
RQV30008 | MERS-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2798bp) |
RQV30009 | MERS-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1242bp) |
RQV30010 | MERS-uPE/E Pseudovirus Standard Reference | 1ml | Contains uPE / E fragments(999bp) |
RQV30011 | hCov-229E-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2780bp) |
RQV30012 | hCov-229E-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1170bp) |
RQV30013 | hCov-229E-E Pseudovirus Standard Reference | 1ml | Contains Gene E fragments(234bp) |
RQV30014 | hCov-HKU1-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2783bp) |
RQV30015 | hCov-HKU1-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1326bp) |
RQV30016 | hCov-HKU1-E Pseudovirus Standard Reference | 1ml | Contains Gene E fragments(249bp) |
RQV30017 | hCov-NL63-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2780bp) |
RQV30018 | hCov-NL63-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1134bp) |
RQV30019 | hCov-NL63-E Pseudovirus Standard Reference | 1ml | Contains Gene E fragments(234bp) |
RQV30020 | hCov-OC43-ORF1ab/RdRP Pseudovirus Standard Reference | 1ml | Contains RdRP fragments(2783bp) |
RQV30021 | hCov-OC43-N Pseudovirus Standard Reference | 1ml | Contains Gene N fragments(1347bp) |
RQV30022 | hCov-OC43-E Pseudovirus Standard Reference | 1ml | Contains Gene E fragments(255bp) |